A tandemly reiterated DNA sequence in the long repeat region of herpes simplex virus type 1 found in close proximity to immediate-early mRNA 1.
نویسندگان
چکیده
The 3' end of immediate-early mRNA 1 was mapped precisely within the IRL/TRL genome regions, and the DNA sequences around the 3' end were determined. An AATAAA polyadenylation signal was present 17 base pairs upstream of the 3' end, and eight tandemly repeated copies of a 16-base-pair sequence (GGGGGTGCGTGGGAGT) plus one further closely related copy were located 20 base pairs downstream. Other tandem reiterations present in the herpes simplex virus genome are described and their properties are considered.
منابع مشابه
Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.
A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for t...
متن کاملCharacterization of the IEll0 Gene of Herpes Simplex Virus
We have determined the DNA sequence of the herpes simplex virus type 1 (HSV-1) gene encoding the immediate early protein IE 110, which is involved in transcriptional activation of later virus genes. The locations of the 5' and 3' termini of IE110 mRNA, together with the positions of two introns, were identified. Examination of the DNA sequence suggested that translation starts at the first ATG ...
متن کاملThe DNA sequences of the long repeat region and adjoining parts of the long unique region in the genome of herpes simplex virus type 1.
We have determined the DNA sequence of the long repeat region (RL) in the genome of herpes simplex virus type 1 (HSV-1) strain 17, as 9215 bp of composition 71.6% G + C. In addition, the sequences of parts of the long unique region (UL) adjacent to the terminal (TRL) and internal (IRL) copies of RL were determined (2611 and 3836 bp, respectively). Gene organization in these regions of UL was de...
متن کاملThe structure of the pseudorabies virus genome at the end of the inverted repeat sequences proximal to the junction with the short unique region.
The complete nucleotide sequence is presented of the 2 x 67 kbp BamHI-EcoRV portion of the BamHI 10 fragment of the pseudorabies virus (PRV) genome (strain Ka) containing sequences upstream of the previously reported protein kinase gene, and completing the sequence of this 4008 bp fragment. It is predicted to contain a gene designated RSp40, homologous to gene US1 of herpes simplex virus type 1...
متن کاملDNA sequence of the herpes simplex virus type 1 gene whose product is responsible for transcriptional activation of immediate early promoters.
Previous work has shown that transcriptional activation of herpes simplex virus type 1 (HSV-1) immediate early genes is mediated by a protein species (Vmw65) present in the tegument of infecting virions. This paper describes DNA sequence analysis and mRNA mapping of the Vmw65 gene in HSV-1 strain 17. The Vmw65 coding region was identified as a 490 codon sequence encoding a polypeptide of molecu...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
- Journal of virology
دوره 52 2 شماره
صفحات -
تاریخ انتشار 1984